User:YouKnowWhatTheMusicMeans/MGMT

MGMT, shown here tuning a guitar before methylating.

O-6-methylguanine-DNA methyltransferase, known commercially as MGMT, is a human gene. Originally based on an independent Chromosome, it gained some fame due to its DNA's Progressive themes and Synthesizer riffs. This caused MGMT to re-sign with Columbia Chromosomes (formerly Chromosome 10).

On October 5, 2007, Spin.com named MGMT "Gene of the Day". On November 14, 2007, Rolling Clone pegged MGMT as a top 10 "Gene to Watch" in 2008. The gene was named 9th in the BBC's Nucleotide of 2008 top 10 poll. MGMT were also named as Last.fm.nucleolus' most methylated gene of 2008 in their Best of 2008 lists.

MGMT is often confused with O-6-methylguanine-DNA methyltransferase, a protein of the same name. They are not related.

Coding Styles

MGMT is well known for it's progressive style of gene copying, and is credited with bringing that style of copying back into favor since the rise of Punk copying in the late 70's. For example, MGMT has coded in odd time signatures 7/8 and 9/8 compound meter. MGMT uses some previously forgotten equipment in order to achieve that sound, such as the Minimoog enzyme sequencer. "Though [MGMT's] coding is at it's most psychedelic," says Blender's Lionel Irving, "that doesn't stop the lyrics from shining through." Indeed, many a critic has praised MGMT's innovative lyrics, including but not limited to "CCCGCGCCCCGG ATATGCTGGGAC AGCCCGC GCCCCTAGAACGCTTTGCG TCCCGACGCCCGCAGGTCC TCGCGGTGCGCACCGTTTGCGACT TGGTGAGTGTCTGGGTCGC CTCGCTCC".

History

MGMT did not originally intend to be a gene, as it was "just messing around with coding n' stuff in college. It was never supposed to get serious," according to the gene itself. The name "MGMT", in it of itself, was a second choice for the gene. MGMT originally coded with the name "Synthesis Management", but there was already another gene methylizing by that name. So, the gene adopted the abreviation "MGMT", itself a backronym for "O-6-methylguanine-DNA methyltransferase". Initially, MGMT experimented with artistic coding. This did not last long, however, as most onlookers viewed it as a "weird-for-the-sake-of-being-weird" thing. After graduating Anaphase University, MGMT released its first Extended Protein-Methylation (EP). MGMT toured extensively around ribosomal subunits in support of the EP, opening for Indie Gene N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2B.

In the autumn of 2006, agent Francis Collins signed MGMT onto Columbia Chromosomes, one of the most influential chromosomes in the nucleolus. Now on a major label, MGMT coded and released its mainstream debut, titled Clonacular Spectacular, in 2007. To support this album, it preformed at the East By East Endoplasmic Reticlum (EXEER) and Mitochondrial City Limits festivals. This album is well known for its catchy single "Time to Synthesize". Most critics around the body in 2007 praised "Time to Synthesize" as an essential enzyme of 2007, with critic Robert Fistgau saying MGMT "convert a quality liberal education into thoughtful, anxious, faux-lite methyl-acceptor residue."

Many fans of "Time to Synthesize" were put off by the gene's sophomore effort, 2010's Codegratulations.